Transcript: Human XM_011529762.2

PREDICTED: Homo sapiens pyridoxal kinase (PDXK), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDXK (8566)
Length:
1319
CDS:
138..662

Additional Resources:

NCBI RefSeq record:
XM_011529762.2
NBCI Gene record:
PDXK (8566)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162543 CCGATAAGTTAAAGATACGCT pLKO.1 1156 3UTR 100% 0.750 1.050 N PDXK n/a
2 TRCN0000160737 CCTGTCCGATAAGTTAAAGAT pLKO.1 1151 3UTR 100% 5.625 4.500 N PDXK n/a
3 TRCN0000163586 GATACGCTGTTTGAGCACAAA pLKO.1 1169 3UTR 100% 4.950 3.465 N PDXK n/a
4 TRCN0000164598 CCTCCTAATTGCCATCATGTT pLKO.1 1004 3UTR 100% 4.950 2.970 N PDXK n/a
5 TRCN0000164996 GCCTCCTAATTGCCATCATGT pLKO.1 1003 3UTR 100% 4.950 2.970 N PDXK n/a
6 TRCN0000162062 GTGTTCAAGGAGAAAGACATT pLKO.1 1067 3UTR 100% 4.950 2.970 N PDXK n/a
7 TRCN0000165554 GTCCGTTCTCACACTGCTAAT pLKO.1 885 3UTR 100% 10.800 5.400 Y PDXK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.