Transcript: Human XM_011530219.2

PREDICTED: Homo sapiens mediator complex subunit 15 (MED15), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MED15 (51586)
Length:
1923
CDS:
98..1318

Additional Resources:

NCBI RefSeq record:
XM_011530219.2
NBCI Gene record:
MED15 (51586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275150 TCTCGTGGCCAGGCTCATTAT pLKO_005 268 CDS 100% 13.200 18.480 N MED15 n/a
2 TRCN0000018969 GCTCAGAACCAACCATCACAA pLKO.1 1028 CDS 100% 4.950 6.930 N MED15 n/a
3 TRCN0000018972 TCCGTCAGTGATCCTATGAAT pLKO.1 326 CDS 100% 5.625 4.500 N MED15 n/a
4 TRCN0000275152 TCCGTCAGTGATCCTATGAAT pLKO_005 326 CDS 100% 5.625 4.500 N MED15 n/a
5 TRCN0000275099 CAACAGCAGCTGCAGCGAATA pLKO_005 800 CDS 100% 10.800 7.560 N MED15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.