Transcript: Human XM_011530343.2

PREDICTED: Homo sapiens solute carrier family 5 member 4 (SLC5A4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC5A4 (6527)
Length:
1988
CDS:
56..1897

Additional Resources:

NCBI RefSeq record:
XM_011530343.2
NBCI Gene record:
SLC5A4 (6527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432995 CTGATAGCTGGACGGATATTT pLKO_005 1184 CDS 100% 15.000 21.000 N SLC5A4 n/a
2 TRCN0000429259 ACAGAGGAGCGAATCGATATA pLKO_005 1616 CDS 100% 13.200 18.480 N SLC5A4 n/a
3 TRCN0000424815 TTAACGAAGTTGGAGGTTATG pLKO_005 585 CDS 100% 10.800 15.120 N SLC5A4 n/a
4 TRCN0000042815 CCGTAACATTTGAATGGACTT pLKO.1 210 CDS 100% 4.050 5.670 N SLC5A4 n/a
5 TRCN0000079637 CCAGTAACTGTCCCAAGATTA pLKO.1 1458 CDS 100% 13.200 9.240 N Slc5a4b n/a
6 TRCN0000424752 GTGATGACCATGCCGGAATAT pLKO_005 290 CDS 100% 13.200 9.240 N SLC5A4 n/a
7 TRCN0000042814 CCACTGGTACAAGTTTCTCAA pLKO.1 1241 CDS 100% 4.950 3.465 N SLC5A4 n/a
8 TRCN0000042813 GCCAGGAATTATATTTGGAAT pLKO.1 745 CDS 100% 4.950 3.465 N SLC5A4 n/a
9 TRCN0000174070 GCCAGGAATTATATTTGGAAT pLKO.1 745 CDS 100% 4.950 3.465 N SLC5A4 n/a
10 TRCN0000042816 CCGCTTGCATTATGTGTGCTT pLKO.1 852 CDS 100% 2.640 1.848 N SLC5A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.