Transcript: Human XM_011530353.2

PREDICTED: Homo sapiens transcription factor 20 (TCF20), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCF20 (6942)
Length:
7496
CDS:
322..6171

Additional Resources:

NCBI RefSeq record:
XM_011530353.2
NBCI Gene record:
TCF20 (6942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015492 GCACAGGCTTATGGAACACAA pLKO.1 1162 CDS 100% 4.950 6.930 N TCF20 n/a
2 TRCN0000297821 GCACAGGCTTATGGAACACAA pLKO_005 1162 CDS 100% 4.950 6.930 N TCF20 n/a
3 TRCN0000280379 TTCCGATGACAAGTGAAATTT pLKO_005 6618 3UTR 100% 15.000 12.000 N TCF20 n/a
4 TRCN0000015491 GCTAGTTTCAACAACAAGAAA pLKO.1 3139 CDS 100% 5.625 4.500 N TCF20 n/a
5 TRCN0000280429 GCTAGTTTCAACAACAAGAAA pLKO_005 3139 CDS 100% 5.625 4.500 N TCF20 n/a
6 TRCN0000015490 CGCTTGATGATATACTGTCTT pLKO.1 4463 CDS 100% 4.950 3.465 N TCF20 n/a
7 TRCN0000280378 CGCTTGATGATATACTGTCTT pLKO_005 4463 CDS 100% 4.950 3.465 N TCF20 n/a
8 TRCN0000015488 CGTGATTCTTTATGTTGTGTT pLKO.1 7319 3UTR 100% 4.950 3.465 N TCF20 n/a
9 TRCN0000015489 GCCACAGAAATGCAGAGCAAA pLKO.1 5545 CDS 100% 4.950 3.465 N TCF20 n/a
10 TRCN0000280427 GCCACAGAAATGCAGAGCAAA pLKO_005 5545 CDS 100% 4.950 3.465 N TCF20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.