Transcript: Human XM_011530431.2

PREDICTED: Homo sapiens kringle containing transmembrane protein 1 (KREMEN1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KREMEN1 (83999)
Length:
7560
CDS:
1739..2851

Additional Resources:

NCBI RefSeq record:
XM_011530431.2
NBCI Gene record:
KREMEN1 (83999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074102 TCCAACAAACTCACCATACAA pLKO.1 1844 CDS 100% 5.625 4.500 N KREMEN1 n/a
2 TRCN0000074099 CCATACAAACTTGCATCAGTT pLKO.1 1857 CDS 100% 4.950 3.960 N KREMEN1 n/a
3 TRCN0000074101 GCAGGATCATCCTCTTTGATA pLKO.1 2034 CDS 100% 5.625 3.938 N KREMEN1 n/a
4 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4220 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530431.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.