Transcript: Human XM_011530438.2

PREDICTED: Homo sapiens zinc and ring finger 3 (ZNRF3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNRF3 (84133)
Length:
6907
CDS:
516..3041

Additional Resources:

NCBI RefSeq record:
XM_011530438.2
NBCI Gene record:
ZNRF3 (84133)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253789 GTCTACCTAATGCACTATTAT pLKO_005 4359 3UTR 100% 15.000 21.000 N ZNRF3 n/a
2 TRCN0000253787 TCCTCGACAACCCACTGAATA pLKO_005 857 CDS 100% 13.200 10.560 N ZNRF3 n/a
3 TRCN0000253788 GAAGGGTGCAGATGCCATTAA pLKO_005 779 CDS 100% 13.200 9.240 N ZNRF3 n/a
4 TRCN0000253790 ACTGTCGGCACAACATCATAG pLKO_005 1225 CDS 100% 10.800 7.560 N ZNRF3 n/a
5 TRCN0000253791 ATGACGAAGAGGACTTGTATG pLKO_005 559 CDS 100% 10.800 7.560 N ZNRF3 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5777 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000160434 CAGTTTCCTCATCTGTAAATA pLKO.1 488 5UTR 100% 15.000 7.500 Y YIF1B n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5777 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.