Transcript: Human XM_011530493.3

PREDICTED: Homo sapiens HPS4 biogenesis of lysosomal organelles complex 3 subunit 2 (HPS4), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPS4 (89781)
Length:
4424
CDS:
655..2736

Additional Resources:

NCBI RefSeq record:
XM_011530493.3
NBCI Gene record:
HPS4 (89781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082978 CCTCAGTTCTATTACGTTATA pLKO.1 3567 3UTR 100% 13.200 18.480 N HPS4 n/a
2 TRCN0000082980 CCAGTGATCTGCATAAGATTT pLKO.1 1103 CDS 100% 13.200 9.240 N HPS4 n/a
3 TRCN0000381995 GGACACCTTCATCGAGCAAAT pLKO_005 1071 CDS 100% 10.800 7.560 N HPS4 n/a
4 TRCN0000379583 GGACCTGTTTCCCTAGCTTAT pLKO_005 1015 CDS 100% 10.800 7.560 N HPS4 n/a
5 TRCN0000382044 TATGATGGTTCCAAGGTAAAG pLKO_005 715 CDS 100% 10.800 7.560 N HPS4 n/a
6 TRCN0000082982 ACCAGTGATCTGCATAAGATT pLKO.1 1102 CDS 100% 5.625 3.938 N HPS4 n/a
7 TRCN0000082981 GCTCGTGAGGATGAATCTCTA pLKO.1 2397 CDS 100% 4.950 3.465 N HPS4 n/a
8 TRCN0000082979 CCCTTGTTATTGCCTCGCTTA pLKO.1 2188 CDS 100% 4.050 2.835 N HPS4 n/a
9 TRCN0000381669 TCCGCTGTGTTTCTGACATTT pLKO_005 836 CDS 100% 13.200 7.920 N HPS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.