Transcript: Human XM_011530552.2

PREDICTED: Homo sapiens RAB36, member RAS oncogene family (RAB36), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB36 (9609)
Length:
5151
CDS:
558..1124

Additional Resources:

NCBI RefSeq record:
XM_011530552.2
NBCI Gene record:
RAB36 (9609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047790 GCCGCATGTGAGCAGGCCGAA pLKO.1 816 CDS 100% 0.000 0.000 N RAB36 n/a
2 TRCN0000381825 CACACACACGGACAGGAATTT pLKO_005 1098 CDS 100% 13.200 9.240 N RAB36 n/a
3 TRCN0000381996 GCACTGTGGTGATCCCATAAA pLKO_005 1312 3UTR 100% 13.200 9.240 N RAB36 n/a
4 TRCN0000382336 TGCATCGCATCTGCCTACTAC pLKO_005 601 CDS 100% 4.950 3.465 N RAB36 n/a
5 TRCN0000382321 TTCCTCGTGGGAACCAAGAAG pLKO_005 780 CDS 100% 4.950 3.465 N RAB36 n/a
6 TRCN0000047791 AGGTCGGCAATGGAGACCTAA pLKO.1 977 CDS 100% 0.495 0.347 N RAB36 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2986 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2986 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.