Transcript: Human XM_011530887.3

PREDICTED: Homo sapiens Nik related kinase (NRK), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRK (203447)
Length:
7445
CDS:
225..4808

Additional Resources:

NCBI RefSeq record:
XM_011530887.3
NBCI Gene record:
NRK (203447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530887.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037489 CCTGAGTCATTACGAGTAAAT pLKO.1 1791 CDS 100% 13.200 18.480 N NRK n/a
2 TRCN0000195363 CCTTAAGGTAGGCGTCAAATT pLKO.1 5611 3UTR 100% 13.200 18.480 N NRK n/a
3 TRCN0000195298 CGACATGTTGTTGAGTCATTA pLKO.1 1017 CDS 100% 13.200 18.480 N NRK n/a
4 TRCN0000196502 GAGATCGAAATGTTAGGTAAT pLKO.1 6952 3UTR 100% 10.800 15.120 N NRK n/a
5 TRCN0000037491 CGGTCACTGATGTAGTGAGAA pLKO.1 466 CDS 100% 0.495 0.396 N NRK n/a
6 TRCN0000194800 CCACAAAGTATACCTCAATAT pLKO.1 6123 3UTR 100% 13.200 9.240 N NRK n/a
7 TRCN0000195269 CCTCTACAAATGCAGATTAAG pLKO.1 1437 CDS 100% 13.200 9.240 N NRK n/a
8 TRCN0000195668 CCATTGGCCTTGGTACTTATG pLKO.1 148 5UTR 100% 10.800 7.560 N NRK n/a
9 TRCN0000037493 CCTGAGGTGATTGACTGTGAT pLKO.1 720 CDS 100% 4.950 3.465 N NRK n/a
10 TRCN0000037490 GCAGCCAATATAGGCAGTGAA pLKO.1 3198 CDS 100% 4.950 3.465 N NRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530887.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.