Transcript: Human XM_011530910.1

PREDICTED: Homo sapiens protocadherin 11 X-linked (PCDH11X), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCDH11X (27328)
Length:
8853
CDS:
433..4563

Additional Resources:

NCBI RefSeq record:
XM_011530910.1
NBCI Gene record:
PCDH11X (27328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056354 CCTAAGAACTTGCTGCTTAAT pLKO.1 3151 CDS 100% 13.200 7.920 N PCDH11X n/a
2 TRCN0000056355 GCTAAGATCAATTACCTGCTA pLKO.1 2014 CDS 100% 2.640 1.584 N PCDH11X n/a
3 TRCN0000056357 CCCATCCATTGACATAAGATA pLKO.1 1575 CDS 100% 5.625 2.813 Y PCDH11X n/a
4 TRCN0000056287 CCAAGGGATGAGCATTGCTTT pLKO.1 820 CDS 100% 4.950 2.475 Y PCDH11Y n/a
5 TRCN0000056285 CCTGTCAATGACACAGTTGTT pLKO.1 1606 CDS 100% 4.950 2.475 Y PCDH11Y n/a
6 TRCN0000056283 CCTTCCAAATTCAGCCTGAAA pLKO.1 3359 CDS 100% 4.950 2.475 Y PCDH11Y n/a
7 TRCN0000056356 GCAGATGATAATGATGAAGAA pLKO.1 3105 CDS 100% 4.950 2.475 Y PCDH11X n/a
8 TRCN0000056284 GCCAGTATTCAGTAATCAGTT pLKO.1 1746 CDS 100% 4.950 2.475 Y PCDH11Y n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6754 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.