Transcript: Human XM_011531236.3

PREDICTED: Homo sapiens teneurin transmembrane protein 1 (TENM1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TENM1 (10178)
Length:
12114
CDS:
1578..7481

Additional Resources:

NCBI RefSeq record:
XM_011531236.3
NBCI Gene record:
TENM1 (10178)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432255 TAGGAGTAGATGCCAATATAA pLKO_005 5722 CDS 100% 15.000 21.000 N TENM1 n/a
2 TRCN0000005276 CCCAGTCATATCAACCATAAT pLKO.1 2678 CDS 100% 13.200 18.480 N TENM1 n/a
3 TRCN0000420964 TCGGGAAACTCCGTTAGTATT pLKO_005 2847 CDS 100% 13.200 18.480 N TENM1 n/a
4 TRCN0000005274 CGGCGTTACATCTTTGAGTAT pLKO.1 4998 CDS 100% 4.950 6.930 N TENM1 n/a
5 TRCN0000421532 GCATAGTAACAGCTGATATTA pLKO_005 6901 CDS 100% 15.000 10.500 N TENM1 n/a
6 TRCN0000432947 GTGTCAGCCCAAGGCTATAAT pLKO_005 4164 CDS 100% 15.000 10.500 N TENM1 n/a
7 TRCN0000005275 GCTGCAATGTTGTCATGGAAA pLKO.1 1564 5UTR 100% 4.950 3.465 N TENM1 n/a
8 TRCN0000005277 CCATTCTCAATAATGCCCATT pLKO.1 6958 CDS 100% 4.050 2.835 N TENM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.