Transcript: Human XM_011531544.2

PREDICTED: Homo sapiens centromere protein E (CENPE), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CENPE (1062)
Length:
8525
CDS:
84..8114

Additional Resources:

NCBI RefSeq record:
XM_011531544.2
NBCI Gene record:
CENPE (1062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412519 GACCACCTTAGAGGATATATA pLKO_005 3657 CDS 100% 15.000 21.000 N CENPE n/a
2 TRCN0000424393 ACCTCATCCAGTTCGCTATTT pLKO_005 7970 CDS 100% 13.200 18.480 N CENPE n/a
3 TRCN0000108301 CCTAGCATAAAGACTGAATTT pLKO.1 6762 CDS 100% 13.200 18.480 N CENPE n/a
4 TRCN0000429387 TTATCGAGATAGCAAGTTAAC pLKO_005 929 CDS 100% 10.800 15.120 N CENPE n/a
5 TRCN0000426276 GCAACTACACAGTCGAATTAT pLKO_005 2424 CDS 100% 15.000 12.000 N CENPE n/a
6 TRCN0000108300 GCCACTAGAGTTGAAAGATAA pLKO.1 8235 3UTR 100% 13.200 9.240 N CENPE n/a
7 TRCN0000108303 CCAAAGATTCAGCACTACTAA pLKO.1 4240 CDS 100% 5.625 3.938 N CENPE n/a
8 TRCN0000108302 GCAGGCATTATGGAGAAACAA pLKO.1 646 CDS 100% 5.625 3.938 N CENPE n/a
9 TRCN0000108304 GCAGCAGGAAACTATTGACAA pLKO.1 5363 CDS 100% 4.950 3.465 N CENPE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.