Transcript: Human XM_011531658.3

PREDICTED: Homo sapiens MGAT4 family member D (MGAT4D), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MGAT4D (152586)
Length:
2831
CDS:
825..1652

Additional Resources:

NCBI RefSeq record:
XM_011531658.3
NBCI Gene record:
MGAT4D (152586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531658.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146392 CGCAGGAGAAGATCTTAGAAA pLKO.1 1520 CDS 100% 5.625 3.938 N MGAT4D n/a
2 TRCN0000148185 GAGGACTTAACTCACTTTGTA pLKO.1 1422 CDS 100% 5.625 3.938 N MGAT4D n/a
3 TRCN0000146834 CTACAAAGAGAAACCCATAGA pLKO.1 1460 CDS 100% 4.950 3.465 N MGAT4D n/a
4 TRCN0000146684 CTGTTTAGATCTGAGGACTTA pLKO.1 1410 CDS 100% 4.950 3.465 N MGAT4D n/a
5 TRCN0000150122 CTTAACTCACTTTGTACGGTT pLKO.1 1427 CDS 100% 2.640 1.848 N MGAT4D n/a
6 TRCN0000150150 GTTCTACAAAGAGAAACCCAT pLKO.1 1457 CDS 100% 2.640 1.848 N MGAT4D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531658.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.