Transcript: Human XM_011532049.2

PREDICTED: Homo sapiens dachsous cadherin-related 2 (DCHS2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCHS2 (54798)
Length:
6206
CDS:
925..6045

Additional Resources:

NCBI RefSeq record:
XM_011532049.2
NBCI Gene record:
DCHS2 (54798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055634 CCGTATTACTTCTGGATACAA pLKO.1 3443 CDS 100% 5.625 7.875 N DCHS2 n/a
2 TRCN0000055637 CCGGAATGGTTGAGTTTAATA pLKO.1 5134 CDS 100% 15.000 10.500 N DCHS2 n/a
3 TRCN0000055635 GCCACAGACTTAGAAAGCAAT pLKO.1 3340 CDS 100% 4.950 3.465 N DCHS2 n/a
4 TRCN0000055633 GCTCTATAAATGCTCTGGATT pLKO.1 4295 CDS 100% 4.950 3.465 N DCHS2 n/a
5 TRCN0000055636 GAGCCCAAATTCCAACCTCTT pLKO.1 5650 CDS 100% 4.050 2.835 N DCHS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.