Transcript: Human XM_011532131.1

PREDICTED: Homo sapiens storkhead box 2 (STOX2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STOX2 (56977)
Length:
9713
CDS:
829..3471

Additional Resources:

NCBI RefSeq record:
XM_011532131.1
NBCI Gene record:
STOX2 (56977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138638 CCCGACAAATGAAGCTGAGAA pLKO.1 3402 CDS 100% 4.950 6.930 N STOX2 n/a
2 TRCN0000138222 CGGGCTAAAGTTATTCCGGTT pLKO.1 1488 CDS 100% 2.160 3.024 N STOX2 n/a
3 TRCN0000137542 CACAGTGGACAGTGGATTCAA pLKO.1 3246 CDS 100% 5.625 3.938 N STOX2 n/a
4 TRCN0000135669 GACTATTACAACGTCTCTGAT pLKO.1 3004 CDS 100% 4.950 3.465 N STOX2 n/a
5 TRCN0000137285 GAGGTGTGTATTCCAGAGATA pLKO.1 2347 CDS 100% 4.950 3.465 N STOX2 n/a
6 TRCN0000137938 GCCTCAGATCTTCTGTCTCAT pLKO.1 3482 3UTR 100% 4.950 3.465 N STOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.