Transcript: Human XM_011532165.2

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 13 (PTPN13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN13 (5783)
Length:
8633
CDS:
489..8012

Additional Resources:

NCBI RefSeq record:
XM_011532165.2
NBCI Gene record:
PTPN13 (5783)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338185 TTCGATGGATAAGTATCATAT pLKO_005 5747 CDS 100% 13.200 18.480 N PTPN13 n/a
2 TRCN0000002889 GCCACGGTCTATTCTTACTAA pLKO.1 2156 CDS 100% 5.625 7.875 N PTPN13 n/a
3 TRCN0000338241 GCCACGGTCTATTCTTACTAA pLKO_005 2156 CDS 100% 5.625 7.875 N PTPN13 n/a
4 TRCN0000338242 CAAGGACATGGTGAGTCTATT pLKO_005 8295 3UTR 100% 13.200 9.240 N PTPN13 n/a
5 TRCN0000002891 CCAGAGTTTGAGGACAGTAAT pLKO.1 5655 CDS 100% 13.200 9.240 N PTPN13 n/a
6 TRCN0000002892 CCAGTGAAAGTCCATCTATTA pLKO.1 1732 CDS 100% 13.200 9.240 N PTPN13 n/a
7 TRCN0000338184 CCAGTGAAAGTCCATCTATTA pLKO_005 1732 CDS 100% 13.200 9.240 N PTPN13 n/a
8 TRCN0000002888 CCTTTGGATCAGTGTCTAATT pLKO.1 7227 CDS 100% 13.200 9.240 N PTPN13 n/a
9 TRCN0000350966 CCTTTGGATCAGTGTCTAATT pLKO_005 7227 CDS 100% 13.200 9.240 N PTPN13 n/a
10 TRCN0000002890 GCATCATCTGTTTGTAATCAT pLKO.1 8552 3UTR 100% 5.625 3.938 N PTPN13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.