Transcript: Human XM_011532214.1

PREDICTED: Homo sapiens tolloid like 1 (TLL1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TLL1 (7092)
Length:
8049
CDS:
1234..3747

Additional Resources:

NCBI RefSeq record:
XM_011532214.1
NBCI Gene record:
TLL1 (7092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378993 GTGTAAACCAGATCCATATAA pLKO_005 4198 3UTR 100% 15.000 21.000 N TLL1 n/a
2 TRCN0000054112 GCCTTTAGTGAATTTGAGATT pLKO.1 3148 CDS 100% 4.950 3.960 N TLL1 n/a
3 TRCN0000373695 TCCATGCTTGATGGTATTAAT pLKO_005 3944 3UTR 100% 15.000 10.500 N TLL1 n/a
4 TRCN0000373697 TTGTGCTGGTATGACTATATT pLKO_005 1906 CDS 100% 15.000 10.500 N TLL1 n/a
5 TRCN0000373696 ATATGGCCTGGAGGCGTTATT pLKO_005 1171 5UTR 100% 13.200 9.240 N TLL1 n/a
6 TRCN0000054109 CCAGTTCAACAATATGAGAAT pLKO.1 2814 CDS 100% 4.950 3.465 N TLL1 n/a
7 TRCN0000054110 GCCTTAGATGATGAAGACTTA pLKO.1 857 5UTR 100% 4.950 3.465 N TLL1 n/a
8 TRCN0000054108 CCGCTACATCAAGAACGGAAA pLKO.1 1148 5UTR 100% 4.050 2.835 N TLL1 n/a
9 TRCN0000031410 GCCTCGATTATGATTACACTT pLKO.1 756 5UTR 100% 4.950 2.970 N Tll1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.