Transcript: Human XM_011532387.2

PREDICTED: Homo sapiens serine protease 12 (PRSS12), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRSS12 (8492)
Length:
2784
CDS:
323..2044

Additional Resources:

NCBI RefSeq record:
XM_011532387.2
NBCI Gene record:
PRSS12 (8492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294461 AGCATGGCATCAGGCATATTT pLKO_005 1306 CDS 100% 15.000 10.500 N PRSS12 n/a
2 TRCN0000050978 CGGCTTTGATTCTGTCCTCAA pLKO.1 379 CDS 100% 4.050 2.835 N PRSS12 n/a
3 TRCN0000287074 CGGCTTTGATTCTGTCCTCAA pLKO_005 379 CDS 100% 4.050 2.835 N PRSS12 n/a
4 TRCN0000050982 GCACAGTGGAAGTATATGCAA pLKO.1 864 CDS 100% 3.000 2.100 N PRSS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.