Transcript: Human XM_011533047.3

PREDICTED: Homo sapiens solute carrier family 3 member 1 (SLC3A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC3A1 (6519)
Length:
4396
CDS:
73..1767

Additional Resources:

NCBI RefSeq record:
XM_011533047.3
NBCI Gene record:
SLC3A1 (6519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419294 ATTTCGGGCCTTCCCGCTAAA pLKO_005 3984 3UTR 100% 10.800 15.120 N SLC3A1 n/a
2 TRCN0000043415 GCCATACATGATAAAGGTTTA pLKO.1 667 CDS 100% 10.800 15.120 N SLC3A1 n/a
3 TRCN0000424199 CACGAGTGATAAACATATTTG pLKO_005 717 CDS 100% 13.200 10.560 N SLC3A1 n/a
4 TRCN0000433904 AGATCGGCTTTGAAGTTATAT pLKO_005 3789 3UTR 100% 15.000 10.500 N SLC3A1 n/a
5 TRCN0000433004 TCTCAATGAAAGCTATGATAT pLKO_005 1551 CDS 100% 13.200 9.240 N SLC3A1 n/a
6 TRCN0000043414 CCAAGTAAATAAGACCCAAAT pLKO.1 1059 CDS 100% 10.800 7.560 N SLC3A1 n/a
7 TRCN0000043417 GCTTTCAGAGATAGATGCTTT pLKO.1 4134 3UTR 100% 4.950 3.465 N SLC3A1 n/a
8 TRCN0000043416 CCATTTATCCAAGAAGCTGAT pLKO.1 1270 CDS 100% 4.050 2.835 N SLC3A1 n/a
9 TRCN0000043413 CCTATAACTTACTATGGAGAA pLKO.1 1498 CDS 100% 4.050 2.835 N SLC3A1 n/a
10 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 1917 3UTR 100% 10.800 5.400 Y MRPS16 n/a
11 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 1917 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.