Transcript: Human XM_011533205.2

PREDICTED: Homo sapiens SERTA domain containing 2 (SERTAD2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SERTAD2 (9792)
Length:
5602
CDS:
352..1296

Additional Resources:

NCBI RefSeq record:
XM_011533205.2
NBCI Gene record:
SERTAD2 (9792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533205.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234191 ACCTTACAGCGCCAGACTATC pLKO_005 451 CDS 100% 10.800 15.120 N Sertad2 n/a
2 TRCN0000138956 GCTGACATTGATACGTCCATG pLKO.1 1096 CDS 100% 4.050 5.670 N SERTAD2 n/a
3 TRCN0000336594 GCTGACATTGATACGTCCATG pLKO_005 1096 CDS 100% 4.050 5.670 N SERTAD2 n/a
4 TRCN0000336596 TCCCTTATGAAACTCTATAAC pLKO_005 481 CDS 100% 13.200 9.240 N SERTAD2 n/a
5 TRCN0000134863 CCAGACTATCTTCAACATTTC pLKO.1 462 CDS 100% 10.800 7.560 N SERTAD2 n/a
6 TRCN0000336595 CTGCGACTGACAGTGTGAAAG pLKO_005 923 CDS 100% 10.800 7.560 N SERTAD2 n/a
7 TRCN0000350764 GAGTGCCTTCATCCAAGTATG pLKO_005 1453 3UTR 100% 10.800 7.560 N SERTAD2 n/a
8 TRCN0000136043 GACATCCTGTTTGCTGACATT pLKO.1 1084 CDS 100% 4.950 3.465 N SERTAD2 n/a
9 TRCN0000336593 GACATCCTGTTTGCTGACATT pLKO_005 1084 CDS 100% 4.950 3.465 N SERTAD2 n/a
10 TRCN0000138631 CTGGATGACATCCTGTTTGCT pLKO.1 1078 CDS 100% 3.000 2.100 N SERTAD2 n/a
11 TRCN0000134435 GCACAAGGATTAAGTTGGAAA pLKO.1 1594 3UTR 100% 4.950 2.970 N SERTAD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533205.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.