Transcript: Human XM_011533458.2

PREDICTED: Homo sapiens chromosome 3 open reading frame 67 (C3orf67), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C3orf67 (200844)
Length:
2685
CDS:
162..2231

Additional Resources:

NCBI RefSeq record:
XM_011533458.2
NBCI Gene record:
C3orf67 (200844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168113 CGGTAGCTCTTCAGGAAATAA pLKO.1 920 CDS 100% 15.000 21.000 N C3orf67 n/a
2 TRCN0000422220 ACGGAAGATCTTCACCTTAAA pLKO_005 284 CDS 100% 13.200 18.480 N C3orf67 n/a
3 TRCN0000167352 CAGAAGAAGATTACGGTTAAA pLKO.1 866 CDS 100% 13.200 18.480 N C3orf67 n/a
4 TRCN0000419839 TAGCAGTTCAGGGTCGCTTAA pLKO_005 2278 3UTR 100% 10.800 15.120 N C3orf67 n/a
5 TRCN0000167623 GAGTTTGAATTGGTTCTTGTT pLKO.1 2462 3UTR 100% 4.950 6.930 N C3orf67 n/a
6 TRCN0000167486 GTTCAACGTTAAGAATACCTA pLKO.1 2377 3UTR 100% 3.000 4.200 N C3orf67 n/a
7 TRCN0000168061 CCCTTGTCTGAACTGTTACTT pLKO.1 2174 CDS 100% 5.625 4.500 N C3orf67 n/a
8 TRCN0000420265 GATGAGCCTACAGATATTATA pLKO_005 363 CDS 100% 15.000 10.500 N C3orf67 n/a
9 TRCN0000166895 CAGAATCAGATCAGTTCATTA pLKO.1 493 CDS 100% 13.200 9.240 N C3orf67 n/a
10 TRCN0000421223 GATGTTTGTCATATCGCATTT pLKO_005 552 CDS 100% 10.800 7.560 N C3orf67 n/a
11 TRCN0000167777 GATCAATCAGATGAGTGGATT pLKO.1 1035 CDS 100% 4.950 3.465 N C3orf67 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.