Transcript: Human XM_011534469.1

PREDICTED: Homo sapiens ATPase phospholipid transporting 10B (putative) (ATP10B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP10B (23120)
Length:
7387
CDS:
669..5054

Additional Resources:

NCBI RefSeq record:
XM_011534469.1
NBCI Gene record:
ATP10B (23120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254309 CCTTAAGCTAGTACCTATATA pLKO_005 6314 3UTR 100% 15.000 21.000 N ATP10B n/a
2 TRCN0000254312 CTTTGCCATCACCCGCTTTAA pLKO_005 3923 CDS 100% 13.200 18.480 N ATP10B n/a
3 TRCN0000254310 ATGATGAAGAGACCGATTTAT pLKO_005 1882 CDS 100% 15.000 10.500 N ATP10B n/a
4 TRCN0000254308 TGCTCCAACATTCGAATTTAT pLKO_005 1113 CDS 100% 15.000 10.500 N ATP10B n/a
5 TRCN0000254311 TGATTCAAGCTGCTGATATTG pLKO_005 3853 CDS 100% 13.200 9.240 N ATP10B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.