Transcript: Human XM_011535158.2

PREDICTED: Homo sapiens ring finger protein 17 (RNF17), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF17 (56163)
Length:
7050
CDS:
1880..6853

Additional Resources:

NCBI RefSeq record:
XM_011535158.2
NBCI Gene record:
RNF17 (56163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062778 GCGAAGATTGTTGCCATTAAA pLKO.1 6473 CDS 100% 15.000 21.000 N RNF17 n/a
2 TRCN0000073059 CCACAATTATATGCCCTGATT pLKO.1 2160 CDS 100% 4.950 6.930 N RNF17 n/a
3 TRCN0000062782 CCTTCTCATCTTATGCGGTAT pLKO.1 6578 CDS 100% 4.050 5.670 N RNF17 n/a
4 TRCN0000062780 CCAGAACAGATAGTGACATTA pLKO.1 6764 CDS 100% 13.200 9.240 N RNF17 n/a
5 TRCN0000073061 GCTGTAATGTTGGACACTAAT pLKO.1 2378 CDS 100% 13.200 9.240 N RNF17 n/a
6 TRCN0000062779 GCTGTTAAGATCCAAGATAAA pLKO.1 5015 CDS 100% 13.200 9.240 N RNF17 n/a
7 TRCN0000062781 GCCACCAGCTATTCCTAACAT pLKO.1 5626 CDS 100% 5.625 3.938 N RNF17 n/a
8 TRCN0000073060 CCATGCTCATTGAAAGACATT pLKO.1 3683 CDS 100% 4.950 3.465 N RNF17 n/a
9 TRCN0000073062 CCAACCAGATTATTTGTCCAT pLKO.1 3464 CDS 100% 2.640 1.848 N RNF17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535158.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.