Transcript: Human XM_011535222.2

PREDICTED: Homo sapiens zinc finger MYM-type containing 2 (ZMYM2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZMYM2 (7750)
Length:
3823
CDS:
71..3775

Additional Resources:

NCBI RefSeq record:
XM_011535222.2
NBCI Gene record:
ZMYM2 (7750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118855 CGGGCGAGATATGAACTTAAT pLKO.1 754 CDS 100% 13.200 18.480 N ZMYM2 n/a
2 TRCN0000118856 GCGAAACTCTTTACCTCAATA pLKO.1 1900 CDS 100% 13.200 18.480 N ZMYM2 n/a
3 TRCN0000433124 TAACTATGGGTTAGCTCATTT pLKO_005 3490 CDS 100% 13.200 18.480 N ZMYM2 n/a
4 TRCN0000071325 GCATAGTTACATATTGCGAAT pLKO.1 2163 CDS 100% 4.050 5.670 N Zmym2 n/a
5 TRCN0000071326 GCTGAGCTTAACTATGGGTTA pLKO.1 3482 CDS 100% 4.050 5.670 N Zmym2 n/a
6 TRCN0000427992 ACTTGTTCAGATGACTATAAG pLKO_005 2132 CDS 100% 13.200 10.560 N ZMYM2 n/a
7 TRCN0000118854 GCCAAGTGATATTCAGTTGAA pLKO.1 2029 CDS 100% 4.950 3.960 N ZMYM2 n/a
8 TRCN0000431264 CTTTAGTGTCTAGATCTAATA pLKO_005 258 CDS 100% 13.200 9.240 N ZMYM2 n/a
9 TRCN0000071327 GCTCCAAAGAAACTCTGTGTT pLKO.1 1238 CDS 100% 4.950 3.465 N Zmym2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535222.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.