Transcript: Human XM_011535243.1

PREDICTED: Homo sapiens intraflagellar transport 88 (IFT88), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IFT88 (8100)
Length:
3720
CDS:
1057..3531

Additional Resources:

NCBI RefSeq record:
XM_011535243.1
NBCI Gene record:
IFT88 (8100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535243.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139796 CACGGCAGTTACTAGACCTAT pLKO.1 1230 CDS 100% 4.950 3.960 N IFT88 n/a
2 TRCN0000144372 CCAAGTTCCAAGTGTCAATAA pLKO.1 1839 CDS 100% 13.200 9.240 N IFT88 n/a
3 TRCN0000145327 GCAGTTACATACTTGAGACAA pLKO.1 2320 CDS 100% 4.950 3.465 N IFT88 n/a
4 TRCN0000141713 GCCGAAGTTCTTTACCAGATA pLKO.1 2710 CDS 100% 4.950 3.465 N IFT88 n/a
5 TRCN0000141190 CTCTGGCATCATCAATAGGAA pLKO.1 1277 CDS 100% 3.000 2.100 N IFT88 n/a
6 TRCN0000144030 CCAATCTATGATATCGAGGAA pLKO.1 1129 CDS 100% 2.640 1.848 N IFT88 n/a
7 TRCN0000144819 GCTTCTCAATATGTAGAGCTA pLKO.1 2275 CDS 100% 2.640 1.848 N IFT88 n/a
8 TRCN0000142052 GCCTTATGAGATCATCCTCAT pLKO.1 3566 3UTR 100% 0.405 0.284 N IFT88 n/a
9 TRCN0000145198 GAACAAGTTACAACTCCAGAA pLKO.1 1603 CDS 100% 4.050 2.430 N IFT88 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535243.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.