Transcript: Human XM_011535363.3

PREDICTED: Homo sapiens double C2 domain beta (DOC2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOC2B (8447)
Length:
1716
CDS:
43..1206

Additional Resources:

NCBI RefSeq record:
XM_011535363.3
NBCI Gene record:
DOC2B (8447)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415596 AGGACAAATTCCGGCACAATG pLKO_005 623 CDS 100% 10.800 15.120 N DOC2B n/a
2 TRCN0000158338 CAAGCAGATCTCCGACTACTT pLKO.1 132 CDS 100% 4.950 6.930 N DOC2B n/a
3 TRCN0000158362 CCCGGAGTTTAATGAGGAGTT pLKO.1 957 CDS 100% 4.050 5.670 N DOC2B n/a
4 TRCN0000157317 CTCACTTACTACGGGATCACA pLKO.1 556 CDS 100% 3.000 4.200 N DOC2B n/a
5 TRCN0000157723 CCAAACATAAGACAGCGGTGA pLKO.1 920 CDS 100% 2.160 3.024 N DOC2B n/a
6 TRCN0000421110 GAACGAGACCCTCACTTACTA pLKO_005 546 CDS 100% 5.625 3.938 N DOC2B n/a
7 TRCN0000156833 GCTGTATGACCAGGAGAACAA pLKO.1 444 CDS 100% 4.950 3.465 N DOC2B n/a
8 TRCN0000156433 CCCAAGAAAGCCTAACTGCAT pLKO.1 1639 3UTR 100% 2.640 1.848 N DOC2B n/a
9 TRCN0000022743 CCTCAAGTACAGCTCACAGAA pLKO.1 786 CDS 100% 4.950 2.970 N Doc2b n/a
10 TRCN0000157757 CGGGATCACAGATGAAGACAT pLKO.1 567 CDS 100% 4.950 2.970 N DOC2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.