Transcript: Human XM_011535501.3

PREDICTED: Homo sapiens sodium/potassium transporting ATPase interacting 2 (NKAIN2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NKAIN2 (154215)
Length:
3395
CDS:
257..898

Additional Resources:

NCBI RefSeq record:
XM_011535501.3
NBCI Gene record:
NKAIN2 (154215)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535501.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168380 GACCTCGTTACATAACAGGAT pLKO.1 429 CDS 100% 2.640 3.696 N NKAIN2 n/a
2 TRCN0000265582 GGCACCTATCCTGGCAAATTT pLKO_005 358 CDS 100% 15.000 10.500 N Nkain2 n/a
3 TRCN0000172897 GCTCATAGTTCCCTCCAGATT pLKO.1 701 CDS 100% 4.950 3.465 N NKAIN2 n/a
4 TRCN0000166921 CTCATTTACAACTACAGCCTA pLKO.1 846 CDS 100% 2.640 1.848 N NKAIN2 n/a
5 TRCN0000174713 GCTTATCTTTATCTGTGGCAT pLKO.1 283 CDS 100% 2.640 1.848 N Nkain2 n/a
6 TRCN0000167224 CCTGAGACATTAAACTCAATT pLKO.1 2414 3UTR 100% 13.200 7.920 N NKAIN2 n/a
7 TRCN0000168475 GCTTTGATTTCATAGGTGGCT pLKO.1 789 CDS 100% 0.660 0.396 N NKAIN2 n/a
8 TRCN0000134959 GAGGACAGCTTTGATTTCATT pLKO.1 782 CDS 100% 5.625 2.813 Y NKAIN4 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1124 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535501.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.