Transcript: Human XM_011535574.1

PREDICTED: Homo sapiens TBC1 domain family member 32 (TBC1D32), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D32 (221322)
Length:
5303
CDS:
394..4026

Additional Resources:

NCBI RefSeq record:
XM_011535574.1
NBCI Gene record:
TBC1D32 (221322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435357 GTCCTACAGGTGCTCATATAA pLKO_005 1799 CDS 100% 15.000 21.000 N TBC1D32 n/a
2 TRCN0000146899 CCTAATATGACTCGCTTACTT pLKO.1 913 CDS 100% 5.625 7.875 N TBC1D32 n/a
3 TRCN0000413519 TCATGAGACACACGGTTTAAA pLKO_005 4028 3UTR 100% 15.000 12.000 N TBC1D32 n/a
4 TRCN0000416829 AGACTTCTTGAAACGAAATAT pLKO_005 1177 CDS 100% 15.000 10.500 N TBC1D32 n/a
5 TRCN0000426736 CTGTAGAAGAAGGGCTTATTT pLKO_005 1739 CDS 100% 15.000 10.500 N TBC1D32 n/a
6 TRCN0000435363 TGAAAGCCAAACCTGATATAA pLKO_005 3119 CDS 100% 15.000 10.500 N TBC1D32 n/a
7 TRCN0000148846 CCATATCCTTGGCCAATGTTT pLKO.1 2878 CDS 100% 5.625 3.938 N TBC1D32 n/a
8 TRCN0000128426 GAACAGGTGCTATCAATGAAT pLKO.1 2162 CDS 100% 5.625 3.938 N TBC1D32 n/a
9 TRCN0000130638 CAAAGCCATGTTGTCTCACAA pLKO.1 1057 CDS 100% 4.950 3.465 N TBC1D32 n/a
10 TRCN0000127727 GAATGTGCAGTGGAATGCTTA pLKO.1 1591 CDS 100% 4.950 3.465 N TBC1D32 n/a
11 TRCN0000149261 GCATTGTGAGAGATTCCTGAA pLKO.1 3369 CDS 100% 4.050 2.835 N TBC1D32 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4304 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4466 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.