Transcript: Human XM_011535576.2

PREDICTED: Homo sapiens TBC1 domain family member 32 (TBC1D32), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D32 (221322)
Length:
3710
CDS:
119..3373

Additional Resources:

NCBI RefSeq record:
XM_011535576.2
NBCI Gene record:
TBC1D32 (221322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435357 GTCCTACAGGTGCTCATATAA pLKO_005 1851 CDS 100% 15.000 21.000 N TBC1D32 n/a
2 TRCN0000146899 CCTAATATGACTCGCTTACTT pLKO.1 965 CDS 100% 5.625 7.875 N TBC1D32 n/a
3 TRCN0000416829 AGACTTCTTGAAACGAAATAT pLKO_005 1229 CDS 100% 15.000 10.500 N TBC1D32 n/a
4 TRCN0000426736 CTGTAGAAGAAGGGCTTATTT pLKO_005 1791 CDS 100% 15.000 10.500 N TBC1D32 n/a
5 TRCN0000435363 TGAAAGCCAAACCTGATATAA pLKO_005 3171 CDS 100% 15.000 10.500 N TBC1D32 n/a
6 TRCN0000148846 CCATATCCTTGGCCAATGTTT pLKO.1 2930 CDS 100% 5.625 3.938 N TBC1D32 n/a
7 TRCN0000128426 GAACAGGTGCTATCAATGAAT pLKO.1 2214 CDS 100% 5.625 3.938 N TBC1D32 n/a
8 TRCN0000130638 CAAAGCCATGTTGTCTCACAA pLKO.1 1109 CDS 100% 4.950 3.465 N TBC1D32 n/a
9 TRCN0000127727 GAATGTGCAGTGGAATGCTTA pLKO.1 1643 CDS 100% 4.950 3.465 N TBC1D32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.