Transcript: Human XM_011535636.3

PREDICTED: Homo sapiens midasin AAA ATPase 1 (MDN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MDN1 (23195)
Length:
16675
CDS:
185..15913

Additional Resources:

NCBI RefSeq record:
XM_011535636.3
NBCI Gene record:
MDN1 (23195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535636.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136951 CGAGGATAATGCCATTGAGAT pLKO.1 14350 CDS 100% 4.950 6.930 N MDN1 n/a
2 TRCN0000229952 CATCCTGACTTCCGTTTATTT pLKO_005 2804 CDS 100% 15.000 12.000 N MDN1 n/a
3 TRCN0000218487 AGACTTGCTTGGAGGTTATAA pLKO_005 2314 CDS 100% 15.000 10.500 N MDN1 n/a
4 TRCN0000229954 ATGGACAGATCTTAGTATATT pLKO_005 7554 CDS 100% 15.000 10.500 N MDN1 n/a
5 TRCN0000229953 CAACCACTGTGTGCGTATTAA pLKO_005 3490 CDS 100% 15.000 10.500 N MDN1 n/a
6 TRCN0000136876 CCAAGCACATTCTCATGCAAA pLKO.1 12531 CDS 100% 4.950 3.465 N MDN1 n/a
7 TRCN0000137307 GCAACAGTCAACTACGAGATT pLKO.1 13324 CDS 100% 4.950 3.465 N MDN1 n/a
8 TRCN0000138916 GCCATTGAGATGTCGGAAGAT pLKO.1 14360 CDS 100% 4.950 3.465 N MDN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535636.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.