Transcript: Human XM_011535648.3

PREDICTED: Homo sapiens PHD finger protein 3 (PHF3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF3 (23469)
Length:
7830
CDS:
87..6233

Additional Resources:

NCBI RefSeq record:
XM_011535648.3
NBCI Gene record:
PHF3 (23469)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535648.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238713 TGTTGGTCTTGACGATATTAT pLKO_005 359 CDS 100% 15.000 21.000 N Phf3 n/a
2 TRCN0000238712 CACTTAGATGATGCCCTATTT pLKO_005 156 CDS 100% 13.200 18.480 N Phf3 n/a
3 TRCN0000019116 CCTCGTTTAATGGCACAAGAA pLKO.1 501 CDS 100% 4.950 6.930 N PHF3 n/a
4 TRCN0000019114 CGCCAATAAGTCATTGGAGAA pLKO.1 3353 CDS 100% 0.405 0.567 N PHF3 n/a
5 TRCN0000274376 ATCTATTGTTGGGCTTAATTA pLKO_005 4132 CDS 100% 15.000 10.500 N PHF3 n/a
6 TRCN0000019118 GCAACTGGATAGGCCATTTAA pLKO.1 5834 CDS 100% 15.000 10.500 N PHF3 n/a
7 TRCN0000274413 GCAACTGGATAGGCCATTTAA pLKO_005 5834 CDS 100% 15.000 10.500 N PHF3 n/a
8 TRCN0000019117 GCAGCAAAGTATGAAGTAATA pLKO.1 1644 CDS 100% 13.200 9.240 N PHF3 n/a
9 TRCN0000274375 GCAGCAAAGTATGAAGTAATA pLKO_005 1644 CDS 100% 13.200 9.240 N PHF3 n/a
10 TRCN0000019115 CCAGTCAAGTAGCGTTTCTTA pLKO.1 1532 CDS 100% 5.625 3.938 N PHF3 n/a
11 TRCN0000274412 CCAGTCAAGTAGCGTTTCTTA pLKO_005 1532 CDS 100% 5.625 3.938 N PHF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535648.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.