Transcript: Human XM_011535756.2

PREDICTED: Homo sapiens filamin A interacting protein 1 (FILIP1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FILIP1 (27145)
Length:
3772
CDS:
268..3165

Additional Resources:

NCBI RefSeq record:
XM_011535756.2
NBCI Gene record:
FILIP1 (27145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137560 CTGACCAAAGAGTTGGAGCTT pLKO.1 1837 CDS 100% 2.640 3.696 N FILIP1 n/a
2 TRCN0000418599 AGAGAAGATTCACGAATTAAT pLKO_005 1707 CDS 100% 15.000 10.500 N FILIP1 n/a
3 TRCN0000413557 TGTACCTTGTTCCACAATAAT pLKO_005 3535 3UTR 100% 15.000 10.500 N FILIP1 n/a
4 TRCN0000137379 GCTGGTGGATGAAAGACAAAT pLKO.1 270 CDS 100% 13.200 9.240 N FILIP1 n/a
5 TRCN0000414503 ATGCTACTGCTGCCGTGAAAG pLKO_005 3196 3UTR 100% 10.800 7.560 N FILIP1 n/a
6 TRCN0000137207 GCTCAGACTTGAAGTTGAGAA pLKO.1 783 CDS 100% 4.950 3.465 N FILIP1 n/a
7 TRCN0000135617 GTACGGAAATACAACTCCAAT pLKO.1 2671 CDS 100% 4.950 3.465 N FILIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.