Transcript: Human XM_011535809.2

PREDICTED: Homo sapiens centrosomal protein 85 like (CEP85L), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP85L (387119)
Length:
8230
CDS:
1180..3597

Additional Resources:

NCBI RefSeq record:
XM_011535809.2
NBCI Gene record:
CEP85L (387119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268547 TCCATCTAACCATCGAAATAA pLKO_005 1314 CDS 100% 15.000 12.000 N CEP85L n/a
2 TRCN0000268492 CAACTTCAAGTGGCACATTAT pLKO_005 1418 CDS 100% 13.200 9.240 N CEP85L n/a
3 TRCN0000268548 GCCTGTAGACATGACATATAG pLKO_005 1929 CDS 100% 13.200 9.240 N CEP85L n/a
4 TRCN0000168228 CAAAGTTATTCACCTGGCTAT pLKO.1 2221 CDS 100% 4.050 2.835 N CEP85L n/a
5 TRCN0000283715 GCCCATGTGATGCCGTCTAAT pLKO_005 1477 CDS 100% 13.200 7.920 N CEP85L n/a
6 TRCN0000168789 GCATCTACTGAGAAAGAAGTT pLKO.1 2524 CDS 100% 4.950 2.970 N CEP85L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.