Transcript: Human XM_011535919.1

PREDICTED: Homo sapiens pleckstrin homology domain interacting protein (PHIP), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHIP (55023)
Length:
3306
CDS:
227..3232

Additional Resources:

NCBI RefSeq record:
XM_011535919.1
NBCI Gene record:
PHIP (55023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322839 TCGAACTGGCAGACGGATATT pLKO_005 802 CDS 100% 13.200 18.480 N PHIP n/a
2 TRCN0000147009 CGGATATTTACTGGTTCTGAT pLKO.1 815 CDS 100% 4.950 6.930 N PHIP n/a
3 TRCN0000350702 AGCACGTATTTGGCAATTTAA pLKO_005 1390 CDS 100% 15.000 10.500 N PHIP n/a
4 TRCN0000359508 CATGATATGCCTGACGTTATA pLKO_005 3228 CDS 100% 13.200 9.240 N PHIP n/a
5 TRCN0000322838 GATCATATTATTCGGGTTTAT pLKO_005 1250 CDS 100% 13.200 9.240 N PHIP n/a
6 TRCN0000130643 CCATGATATGCCTGACGTTAT pLKO.1 3227 CDS 100% 10.800 7.560 N PHIP n/a
7 TRCN0000149161 GCAGTGTATCAGCACATGAAA pLKO.1 728 CDS 100% 5.625 3.938 N PHIP n/a
8 TRCN0000127738 GCTGGAAGACAGTCTTTACTA pLKO.1 533 CDS 100% 5.625 3.938 N PHIP n/a
9 TRCN0000149327 GACAGTCTTTACTACGCACAA pLKO.1 540 CDS 100% 4.050 2.835 N PHIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.