Transcript: Human XM_011535936.1

PREDICTED: Homo sapiens cAMP-dependent protein kinase inhibitor beta (PKIB), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKIB (5570)
Length:
961
CDS:
28..264

Additional Resources:

NCBI RefSeq record:
XM_011535936.1
NBCI Gene record:
PKIB (5570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002819 CCACAGACGGAACCTCAGATT pLKO.1 140 CDS 100% 4.950 6.930 N PKIB n/a
2 TRCN0000273290 CCACAGACGGAACCTCAGATT pLKO_005 140 CDS 100% 4.950 6.930 N PKIB n/a
3 TRCN0000002815 CACAGACGGAACCTCAGATTT pLKO.1 141 CDS 100% 13.200 9.240 N PKIB n/a
4 TRCN0000380391 GGCAAATCATTCTTGGTAAAT pLKO_005 612 3UTR 100% 13.200 9.240 N PKIB n/a
5 TRCN0000381106 GTGGTAACTGTGGTAACATTG pLKO_005 346 3UTR 100% 10.800 7.560 N PKIB n/a
6 TRCN0000273353 TGAAGGCTCATAATCTATCAA pLKO_005 262 CDS 100% 5.625 3.938 N PKIB n/a
7 TRCN0000002817 CCTTACCAGACATCCAGAGTT pLKO.1 113 CDS 100% 4.950 3.465 N PKIB n/a
8 TRCN0000273289 TCTCCGTGAAGGAAGATGCAA pLKO_005 182 CDS 100% 3.000 2.100 N PKIB n/a
9 TRCN0000002816 CCAGACATCCAGAGTTCAGCT pLKO.1 118 CDS 100% 2.640 1.848 N PKIB n/a
10 TRCN0000273287 CCAGACATCCAGAGTTCAGCT pLKO_005 118 CDS 100% 2.640 1.848 N PKIB n/a
11 TRCN0000273351 ATGTCCAAGGTAAGCTATTAA pLKO_005 435 3UTR 100% 15.000 9.000 N PKIB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.