Transcript: Human XM_011536039.3

PREDICTED: Homo sapiens BTB domain and CNC homolog 2 (BACH2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BACH2 (60468)
Length:
3742
CDS:
434..2959

Additional Resources:

NCBI RefSeq record:
XM_011536039.3
NBCI Gene record:
BACH2 (60468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536039.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421127 AGCACCTCGGTGCATTCTTAT pLKO_005 1757 CDS 100% 13.200 18.480 N BACH2 n/a
2 TRCN0000433722 TGACGAATCCGGATCGTTCTC pLKO_005 2203 CDS 100% 4.050 5.670 N BACH2 n/a
3 TRCN0000018113 CCGGGAAGATAACTCTAGCAA pLKO.1 1204 CDS 100% 3.000 4.200 N BACH2 n/a
4 TRCN0000018117 GCCCAGGAAAGATTATACCTA pLKO.1 2938 CDS 100% 3.000 4.200 N BACH2 n/a
5 TRCN0000018114 CGCAAATTGGTGTGTGAGAAA pLKO.1 2468 CDS 100% 4.950 3.960 N BACH2 n/a
6 TRCN0000423629 TGGCCGCATGCAGTGAATATT pLKO_005 597 CDS 100% 15.000 10.500 N BACH2 n/a
7 TRCN0000436687 ATTAAATGTGAGCAGTCTTAT pLKO_005 2168 CDS 100% 13.200 9.240 N BACH2 n/a
8 TRCN0000429903 CATCTGCTGTCCCGAAGAAAC pLKO_005 3032 3UTR 100% 10.800 7.560 N BACH2 n/a
9 TRCN0000413240 TCGAGCAGGAGTGATAGTTAC pLKO_005 3123 3UTR 100% 10.800 7.560 N BACH2 n/a
10 TRCN0000418256 TGCACACTACAGCGGTCTTAG pLKO_005 3068 3UTR 100% 10.800 7.560 N BACH2 n/a
11 TRCN0000420508 ATGTCGAGATGGACCGGAAAC pLKO_005 1350 CDS 100% 6.000 4.200 N BACH2 n/a
12 TRCN0000084328 GCTTCTATACACATCAAAGTT pLKO.1 3346 3UTR 100% 5.625 3.938 N Bach2 n/a
13 TRCN0000417909 AGAAGGAGGTGTCCAACTTCA pLKO_005 1629 CDS 100% 4.950 3.465 N BACH2 n/a
14 TRCN0000415724 ATATTCTCTGTGACGTGACTT pLKO_005 534 CDS 100% 4.950 3.465 N BACH2 n/a
15 TRCN0000420196 CACAGTCCACTGCACCAACAT pLKO_005 481 CDS 100% 4.950 3.465 N BACH2 n/a
16 TRCN0000018115 CCAGCTTGCATGTACCAAGAA pLKO.1 1135 CDS 100% 4.950 3.465 N BACH2 n/a
17 TRCN0000018116 CCTGTAGATCAAATCACAGAT pLKO.1 2285 CDS 100% 4.950 3.465 N BACH2 n/a
18 TRCN0000428556 TCAGAACAGTTAGAGTTTATT pLKO_005 2354 CDS 100% 15.000 9.000 N BACH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536039.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.