Transcript: Human XM_011536490.2

PREDICTED: Homo sapiens centrosomal protein 128 (CEP128), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP128 (145508)
Length:
11327
CDS:
353..3727

Additional Resources:

NCBI RefSeq record:
XM_011536490.2
NBCI Gene record:
CEP128 (145508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448127 CATAGACTGGAGAGCGAATTG pLKO_005 2117 CDS 100% 10.800 15.120 N CEP128 n/a
2 TRCN0000145613 CCTTGTGAATGGTAAACCAAT pLKO.1 3883 3UTR 100% 4.950 6.930 N CEP128 n/a
3 TRCN0000122316 CGAAAGGGTTTACAGCATCAA pLKO.1 1319 CDS 100% 4.950 6.930 N CEP128 n/a
4 TRCN0000144987 GCTAATAAATTGGCTGAGGAA pLKO.1 2294 CDS 100% 2.640 3.696 N CEP128 n/a
5 TRCN0000142061 GCTTCCTGTCTAGTCCAAGAT pLKO.1 3588 CDS 100% 4.950 3.960 N CEP128 n/a
6 TRCN0000141755 GCTTGGAGACTGAACAGGAAT pLKO.1 2808 CDS 100% 4.950 3.960 N CEP128 n/a
7 TRCN0000142113 GCTTGGACGATACCGAGAATA pLKO.1 535 CDS 100% 13.200 9.240 N CEP128 n/a
8 TRCN0000439480 GGAGGAGAAATTACGTGATAT pLKO_005 2041 CDS 100% 13.200 9.240 N CEP128 n/a
9 TRCN0000144260 CTTTAGATTCAGGGAGCATTT pLKO.1 4120 3UTR 100% 10.800 7.560 N CEP128 n/a
10 TRCN0000451162 TTGAATGATGTCCTAACAAAG pLKO_005 1988 CDS 100% 10.800 7.560 N CEP128 n/a
11 TRCN0000144988 GCAGAAAGCAAGACTAAACTT pLKO.1 2954 CDS 100% 5.625 3.938 N CEP128 n/a
12 TRCN0000145094 GCTATCTCGAAGGTTATTGAA pLKO.1 1219 CDS 100% 5.625 3.938 N CEP128 n/a
13 TRCN0000121946 CCAGATTATCTAACAGACATA pLKO.1 3803 3UTR 100% 4.950 3.465 N CEP128 n/a
14 TRCN0000144220 CGTTGGAGAAACAATCTGAAA pLKO.1 1860 CDS 100% 4.950 3.465 N CEP128 n/a
15 TRCN0000145095 GCAACTTATACTAGCACAGAA pLKO.1 3947 3UTR 100% 4.950 3.465 N CEP128 n/a
16 TRCN0000145262 GCTTTGGAAGAATTGACTGAA pLKO.1 947 CDS 100% 4.950 3.465 N CEP128 n/a
17 TRCN0000141520 CCAGGAGCTTATGAAGCACTT pLKO.1 2497 CDS 100% 4.050 2.835 N CEP128 n/a
18 TRCN0000122374 CGCAGAAATTCTCTTCAGCAT pLKO.1 3455 CDS 100% 2.640 1.848 N CEP128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.