Transcript: Human XM_011536587.3

PREDICTED: Homo sapiens sec1 family domain containing 1 (SCFD1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCFD1 (23256)
Length:
1661
CDS:
25..1488

Additional Resources:

NCBI RefSeq record:
XM_011536587.3
NBCI Gene record:
SCFD1 (23256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536587.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420263 GATGAGGTCAAACGACTTAAA pLKO_005 1081 CDS 100% 13.200 10.560 N SCFD1 n/a
2 TRCN0000093306 CCAGTATGGAAGGTACTCATT pLKO.1 145 CDS 100% 4.950 3.960 N Scfd1 n/a
3 TRCN0000324373 CCAGTATGGAAGGTACTCATT pLKO_005 145 CDS 100% 4.950 3.960 N Scfd1 n/a
4 TRCN0000415207 AGCTTCCAGAGGCCCTTATTA pLKO_005 778 CDS 100% 15.000 10.500 N SCFD1 n/a
5 TRCN0000428780 CAGTATGGAAGGTACTCATTT pLKO_005 146 CDS 100% 13.200 9.240 N SCFD1 n/a
6 TRCN0000146271 CTTGTTTCATATCGTGCCATT pLKO.1 532 CDS 100% 4.050 2.835 N SCFD1 n/a
7 TRCN0000183046 CTTTACATCATACTTGGACAT pLKO.1 833 CDS 100% 4.050 2.835 N SCFD1 n/a
8 TRCN0000148168 GAATCAGTTCAGCAAGAACTA pLKO.1 1039 CDS 100% 0.495 0.347 N SCFD1 n/a
9 TRCN0000093308 GAAACTGTTATGGACACTATT pLKO.1 583 CDS 100% 13.200 9.240 N Scfd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536587.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.