Transcript: Human XM_011536609.2

PREDICTED: Homo sapiens zinc finger FYVE-type containing 26 (ZFYVE26), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFYVE26 (23503)
Length:
5245
CDS:
141..5141

Additional Resources:

NCBI RefSeq record:
XM_011536609.2
NBCI Gene record:
ZFYVE26 (23503)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536609.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158370 CGGCGTTTGAATAGTAGCCTT pLKO.1 3129 CDS 100% 2.640 3.696 N ZFYVE26 n/a
2 TRCN0000157120 GCCCAAGTAGAGCACAAGATT pLKO.1 2781 CDS 100% 5.625 4.500 N ZFYVE26 n/a
3 TRCN0000152598 GCTGCCTACTTGATAGAGAAT pLKO.1 1204 CDS 100% 4.950 3.960 N ZFYVE26 n/a
4 TRCN0000338690 GCTGCCTACTTGATAGAGAAT pLKO_005 1204 CDS 100% 4.950 3.960 N ZFYVE26 n/a
5 TRCN0000157218 GAGGAGCTGTATGAGACCTTA pLKO.1 501 CDS 100% 4.950 3.465 N ZFYVE26 n/a
6 TRCN0000157654 GTGGACGATTTGAGCAGCATA pLKO.1 4458 CDS 100% 4.950 3.465 N ZFYVE26 n/a
7 TRCN0000338756 GTGGACGATTTGAGCAGCATA pLKO_005 4458 CDS 100% 4.950 3.465 N ZFYVE26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536609.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.