Transcript: Human XM_011536760.3

PREDICTED: Homo sapiens HEAT repeat containing 4 (HEATR4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HEATR4 (399671)
Length:
3446
CDS:
244..3324

Additional Resources:

NCBI RefSeq record:
XM_011536760.3
NBCI Gene record:
HEATR4 (399671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435911 ACACCGCAAGAGCCAATATTT pLKO_005 414 CDS 100% 15.000 21.000 N HEATR4 n/a
2 TRCN0000419287 TGAGAAGGATGTGCCTATTAA pLKO_005 1530 CDS 100% 15.000 21.000 N HEATR4 n/a
3 TRCN0000434946 GATAGGTGAGCTCAAGCTTAT pLKO_005 2400 CDS 100% 10.800 15.120 N HEATR4 n/a
4 TRCN0000137489 GCACCAAATCCCTGGTTACAA pLKO.1 3103 CDS 100% 5.625 4.500 N HEATR4 n/a
5 TRCN0000168746 GCTTCCCGTTTACTACAGATT pLKO.1 1107 CDS 100% 4.950 3.960 N HEATR4 n/a
6 TRCN0000134988 CAGCTCTTTATCTGGGTAAAT pLKO.1 3236 CDS 100% 13.200 9.240 N HEATR4 n/a
7 TRCN0000168343 GCAGCAGCAATATGCCAATAT pLKO.1 1885 CDS 100% 13.200 9.240 N HEATR4 n/a
8 TRCN0000416203 ATGATGACGTTCGGATCAAAG pLKO_005 1715 CDS 100% 10.800 7.560 N HEATR4 n/a
9 TRCN0000421182 CCCAAACCCAGAGCTACTTTC pLKO_005 1220 CDS 100% 10.800 7.560 N HEATR4 n/a
10 TRCN0000432003 GAACTGCTGCTTCCCGTTTAC pLKO_005 1099 CDS 100% 10.800 7.560 N HEATR4 n/a
11 TRCN0000137289 GCACCATGAGACAGTAGAGAA pLKO.1 1668 CDS 100% 4.950 3.465 N HEATR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.