Transcript: Human XM_011536805.2

PREDICTED: Homo sapiens neural retina leucine zipper (NRL), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRL (4901)
Length:
3430
CDS:
174..887

Additional Resources:

NCBI RefSeq record:
XM_011536805.2
NBCI Gene record:
NRL (4901)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015368 CCGAATTTAGATGCTGGTCAT pLKO.1 1052 3UTR 100% 4.050 5.670 N NRL n/a
2 TRCN0000423407 CCTGTATGACCGCGCAAATAT pLKO_005 1001 3UTR 100% 15.000 10.500 N NRL n/a
3 TRCN0000424600 TCCACACCTTACAGCTCAGTG pLKO_005 294 CDS 100% 4.050 2.835 N NRL n/a
4 TRCN0000421740 GTTTGAGGTAAAGCGGGAACC pLKO_005 233 CDS 100% 2.250 1.575 N NRL n/a
5 TRCN0000015372 TCGATGTCTGTGCGGGAGCTA pLKO.1 588 CDS 100% 0.880 0.616 N NRL n/a
6 TRCN0000015369 TGTCAATGACTTTGACTTGAT pLKO.1 209 CDS 100% 0.495 0.347 N NRL n/a
7 TRCN0000015371 CCACCTTCAGTGAACCAGGCA pLKO.1 325 CDS 100% 0.220 0.154 N NRL n/a
8 TRCN0000015370 GCGATCTCTACAAGGCTCGCT pLKO.1 808 CDS 100% 0.220 0.154 N NRL n/a
9 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 27 5UTR 100% 13.200 6.600 Y LRRC74B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.