Transcript: Human XM_011536840.2

PREDICTED: Homo sapiens potassium two pore domain channel subfamily K member 10 (KCNK10), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNK10 (54207)
Length:
6886
CDS:
227..1459

Additional Resources:

NCBI RefSeq record:
XM_011536840.2
NBCI Gene record:
KCNK10 (54207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433339 CAATTATCGGGAGTGGTATAA pLKO_005 712 CDS 100% 13.200 18.480 N KCNK10 n/a
2 TRCN0000416674 ATGCGGGAGTCAGTCCAATAG pLKO_005 249 CDS 100% 10.800 15.120 N KCNK10 n/a
3 TRCN0000044578 CCGGAGAACAACTCATTACTT pLKO.1 1424 CDS 100% 5.625 7.875 N KCNK10 n/a
4 TRCN0000044580 GCCTTGGAGTCCATTTACTTT pLKO.1 629 CDS 100% 5.625 3.938 N KCNK10 n/a
5 TRCN0000044581 GCTGGAATTGGAGACCAACTT pLKO.1 440 CDS 100% 4.950 3.465 N KCNK10 n/a
6 TRCN0000044582 GTCCTCAGTATGATCGGAGAT pLKO.1 782 CDS 100% 4.050 2.835 N KCNK10 n/a
7 TRCN0000125693 CCCACTCACTGGACATGCTAT pLKO.1 999 CDS 100% 4.950 2.970 N Kcnk10 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5554 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.