Transcript: Human XM_011536938.3

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 40 (ARHGEF40), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF40 (55701)
Length:
2995
CDS:
177..2951

Additional Resources:

NCBI RefSeq record:
XM_011536938.3
NBCI Gene record:
ARHGEF40 (55701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136388 CGCTGAACACAACTCTTCATT pLKO.1 1876 CDS 100% 5.625 7.875 N ARHGEF40 n/a
2 TRCN0000418282 CACCTGGTTAAGGAGGAATAT pLKO_005 1461 CDS 100% 13.200 9.240 N ARHGEF40 n/a
3 TRCN0000134459 GCTGAACACAACTCTTCATTA pLKO.1 1877 CDS 100% 13.200 9.240 N ARHGEF40 n/a
4 TRCN0000433037 AGAAGGTGCTGGATATCTTTG pLKO_005 2728 CDS 100% 10.800 7.560 N ARHGEF40 n/a
5 TRCN0000135758 CCAACTGAACTCTGTGGATTT pLKO.1 2070 CDS 100% 10.800 7.560 N ARHGEF40 n/a
6 TRCN0000437757 GAGCTCATCTGTCCACGATTT pLKO_005 714 CDS 100% 10.800 7.560 N ARHGEF40 n/a
7 TRCN0000163309 GACACGCTGAACACAACTCTT pLKO.1 1872 CDS 100% 4.950 3.465 N ARHGEF40 n/a
8 TRCN0000161681 GCTGTCAGAGAATGATCTGAA pLKO.1 2105 CDS 100% 0.495 0.347 N ARHGEF40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.