Transcript: Human XM_011537383.3

PREDICTED: Homo sapiens A-kinase anchoring protein 6 (AKAP6), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKAP6 (9472)
Length:
5228
CDS:
38..3982

Additional Resources:

NCBI RefSeq record:
XM_011537383.3
NBCI Gene record:
AKAP6 (9472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537383.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037914 CCTGGCTTGATGGACCTAAAT pLKO.1 632 CDS 100% 13.200 18.480 N AKAP6 n/a
2 TRCN0000229378 TAAGTCCCTCTGTCGTGAAAT pLKO_005 391 CDS 100% 13.200 18.480 N AKAP6 n/a
3 TRCN0000037915 CGGCATCTCTAACAGAACTTA pLKO.1 2076 CDS 100% 5.625 7.875 N AKAP6 n/a
4 TRCN0000037916 CGAAGATTGTTCAGTACACAA pLKO.1 3175 CDS 100% 4.950 6.930 N AKAP6 n/a
5 TRCN0000218838 ACCAACTGGTAGTCCATTAAA pLKO_005 4345 3UTR 100% 15.000 12.000 N AKAP6 n/a
6 TRCN0000229379 GGACATAAGTAACAAGTTAAT pLKO_005 688 CDS 100% 13.200 9.240 N AKAP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537383.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.