Transcript: Human XM_011537415.2

PREDICTED: Homo sapiens apoptosis resistant E3 ubiquitin protein ligase 1 (AREL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AREL1 (9870)
Length:
5075
CDS:
579..3050

Additional Resources:

NCBI RefSeq record:
XM_011537415.2
NBCI Gene record:
AREL1 (9870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004426 GCCCAATTCCAACGTAGTAAA pLKO.1 938 CDS 100% 13.200 18.480 N AREL1 n/a
2 TRCN0000280034 GCCCAATTCCAACGTAGTAAA pLKO_005 938 CDS 100% 13.200 18.480 N AREL1 n/a
3 TRCN0000004423 CGCTCCCTGCATAAGAACATA pLKO.1 1857 CDS 100% 5.625 7.875 N AREL1 n/a
4 TRCN0000010874 CCGGGAATGGTTTGAGCTAAT pLKO.1 2099 CDS 100% 10.800 7.560 N AREL1 n/a
5 TRCN0000280104 CCGGGAATGGTTTGAGCTAAT pLKO_005 2099 CDS 100% 10.800 7.560 N AREL1 n/a
6 TRCN0000004424 CGCAGTCATCATTTGTCCTTT pLKO.1 4584 3UTR 100% 4.950 3.465 N AREL1 n/a
7 TRCN0000280035 CGCAGTCATCATTTGTCCTTT pLKO_005 4584 3UTR 100% 4.950 3.465 N AREL1 n/a
8 TRCN0000004425 CCCAAATCATAGGACTGCGTA pLKO.1 2335 CDS 100% 2.640 1.848 N AREL1 n/a
9 TRCN0000280047 CCCAAATCATAGGACTGCGTA pLKO_005 2335 CDS 100% 2.640 1.848 N AREL1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 225 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 225 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.