Transcript: Human XM_011537417.2

PREDICTED: Homo sapiens apoptosis resistant E3 ubiquitin protein ligase 1 (AREL1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AREL1 (9870)
Length:
4857
CDS:
844..2832

Additional Resources:

NCBI RefSeq record:
XM_011537417.2
NBCI Gene record:
AREL1 (9870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004426 GCCCAATTCCAACGTAGTAAA pLKO.1 720 5UTR 100% 13.200 18.480 N AREL1 n/a
2 TRCN0000280034 GCCCAATTCCAACGTAGTAAA pLKO_005 720 5UTR 100% 13.200 18.480 N AREL1 n/a
3 TRCN0000004423 CGCTCCCTGCATAAGAACATA pLKO.1 1639 CDS 100% 5.625 7.875 N AREL1 n/a
4 TRCN0000010874 CCGGGAATGGTTTGAGCTAAT pLKO.1 1881 CDS 100% 10.800 7.560 N AREL1 n/a
5 TRCN0000280104 CCGGGAATGGTTTGAGCTAAT pLKO_005 1881 CDS 100% 10.800 7.560 N AREL1 n/a
6 TRCN0000004424 CGCAGTCATCATTTGTCCTTT pLKO.1 4366 3UTR 100% 4.950 3.465 N AREL1 n/a
7 TRCN0000280035 CGCAGTCATCATTTGTCCTTT pLKO_005 4366 3UTR 100% 4.950 3.465 N AREL1 n/a
8 TRCN0000004425 CCCAAATCATAGGACTGCGTA pLKO.1 2117 CDS 100% 2.640 1.848 N AREL1 n/a
9 TRCN0000280047 CCCAAATCATAGGACTGCGTA pLKO_005 2117 CDS 100% 2.640 1.848 N AREL1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 234 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 234 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.