Transcript: Human XM_011537642.3

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 37 (ARHGEF37), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF37 (389337)
Length:
4883
CDS:
46..2106

Additional Resources:

NCBI RefSeq record:
XM_011537642.3
NBCI Gene record:
ARHGEF37 (389337)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537642.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418988 AGCTAGTTGGTAACATATTTC pLKO_005 380 CDS 100% 13.200 18.480 N ARHGEF37 n/a
2 TRCN0000454977 ACGTGAACACCAATATCAATG pLKO_005 692 CDS 100% 10.800 7.560 N ARHGEF37 n/a
3 TRCN0000134307 GTCCTGTTCTCAAACATTGAT pLKO.1 286 CDS 100% 5.625 3.938 N ARHGEF37 n/a
4 TRCN0000135325 CCAGCCTCTTTAACTTGGTAA pLKO.1 3338 3UTR 100% 4.950 3.465 N ARHGEF37 n/a
5 TRCN0000136645 GCCTCAGTTTCTTGCTGGTAA pLKO.1 557 CDS 100% 4.950 3.465 N ARHGEF37 n/a
6 TRCN0000137185 GATCAAGAAGCGTCTGGACAA pLKO.1 1158 CDS 100% 4.050 2.835 N ARHGEF37 n/a
7 TRCN0000136037 GCACGAATACAATCTGGACAT pLKO.1 993 CDS 100% 4.050 2.835 N ARHGEF37 n/a
8 TRCN0000137290 GCTAGTTCAAACAGGCGCTTT pLKO.1 4238 3UTR 100% 4.050 2.835 N ARHGEF37 n/a
9 TRCN0000135778 CCTGAAATTTAAGCAACGGCT pLKO.1 1074 CDS 100% 0.660 0.462 N ARHGEF37 n/a
10 TRCN0000137297 GAAGAACAACGTGGCTGCTTA pLKO.1 936 CDS 100% 4.950 2.970 N ARHGEF37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537642.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.