Transcript: Human XM_011537700.3

PREDICTED: Homo sapiens FCH and double SH3 domains 1 (FCHSD1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FCHSD1 (89848)
Length:
1624
CDS:
76..1533

Additional Resources:

NCBI RefSeq record:
XM_011537700.3
NBCI Gene record:
FCHSD1 (89848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246374 CAGCCATTGAACGGGAGTATG pLKO_005 215 CDS 100% 10.800 15.120 N Fchsd1 n/a
2 TRCN0000204343 CCCTGAGCGATATCTCAACTT pLKO.1 1578 3UTR 100% 4.950 6.930 N FCHSD1 n/a
3 TRCN0000246373 GCTTTGTCCCTGAGCGATATC pLKO_005 1571 3UTR 100% 10.800 8.640 N Fchsd1 n/a
4 TRCN0000164001 CCGCAATGAGTACCTGCTTAA pLKO.1 696 CDS 100% 10.800 7.560 N FCHSD1 n/a
5 TRCN0000161823 CAAGACCTGAAGCTGTTTCTT pLKO.1 916 CDS 100% 5.625 3.938 N FCHSD1 n/a
6 TRCN0000161367 GACTACAAGATCCAGAACCAT pLKO.1 1090 CDS 100% 3.000 2.100 N FCHSD1 n/a
7 TRCN0000162676 CTTAACTTGGTGGCTACCAAT pLKO.1 712 CDS 100% 0.495 0.347 N FCHSD1 n/a
8 TRCN0000187290 CCAAGCATAGAACAGAGGTTA pLKO.1 1171 CDS 100% 4.950 2.970 N FCHSD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.