Transcript: Human XM_011537730.3

PREDICTED: Homo sapiens plexin C1 (PLXNC1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLXNC1 (10154)
Length:
5750
CDS:
242..4210

Additional Resources:

NCBI RefSeq record:
XM_011537730.3
NBCI Gene record:
PLXNC1 (10154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537730.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060645 CCCTTCCTTGACTACAAACAT pLKO.1 3281 CDS 100% 5.625 7.875 N PLXNC1 n/a
2 TRCN0000060643 GCCACATTGTTCCCTTATATT pLKO.1 2500 CDS 100% 15.000 10.500 N PLXNC1 n/a
3 TRCN0000060644 CCACAGAAAGTATCGACATTA pLKO.1 2246 CDS 100% 13.200 9.240 N PLXNC1 n/a
4 TRCN0000359468 GCCAGTTACTTAAGGTTATTC pLKO_005 1431 CDS 100% 13.200 9.240 N PLXNC1 n/a
5 TRCN0000359394 TCCGACCTGACATCCGTTTAT pLKO_005 1361 CDS 100% 13.200 9.240 N PLXNC1 n/a
6 TRCN0000359395 TGCAGATGTCTGTCGGAATAT pLKO_005 3880 CDS 100% 13.200 9.240 N PLXNC1 n/a
7 TRCN0000060646 CCTCTTCAGAATGAGTGAGAT pLKO.1 1228 CDS 100% 4.950 3.465 N PLXNC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537730.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.