Transcript: Human XM_011537900.2

PREDICTED: Homo sapiens Sp7 transcription factor (SP7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SP7 (121340)
Length:
3241
CDS:
429..1670

Additional Resources:

NCBI RefSeq record:
XM_011537900.2
NBCI Gene record:
SP7 (121340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021006 GCTAATGATTACCCTCCCTTT pLKO.1 639 CDS 100% 4.050 5.670 N SP7 n/a
2 TRCN0000021007 ACAAGCACTAATGGGCTCCTT pLKO.1 579 CDS 100% 2.640 2.112 N SP7 n/a
3 TRCN0000425503 TTCTGCTTCTCAAGCTTATTT pLKO_005 2019 3UTR 100% 15.000 10.500 N SP7 n/a
4 TRCN0000425548 CCTACTCCATGGTGGGATATG pLKO_005 837 CDS 100% 10.800 7.560 N SP7 n/a
5 TRCN0000021004 CCTCAGGCTATGCTAATGATT pLKO.1 628 CDS 100% 5.625 3.938 N SP7 n/a
6 TRCN0000021005 GCAGCAAATTTGGTGGCTCTA pLKO.1 445 CDS 100% 4.050 2.835 N SP7 n/a
7 TRCN0000021008 CCCAAGATGTCTATAAACCCA pLKO.1 1048 CDS 100% 0.750 0.525 N SP7 n/a
8 TRCN0000429222 AGGCATCCATGCAGGCATTTC pLKO_005 797 CDS 100% 10.800 6.480 N SP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.